CSS: how can I force a long string (without any blank) to be wrapped in XUL and/or HTML -

I have a long string (a DNA sequence). There is no white space character in it: For example: What will be the CSS selector to wrap this text in html: text or axle: text box

  ACTGATCGAGCTGAAGGCGTGCGATGCTCTGCGCAGTGCGATGCTCGAGCGCTGCTGATGCTGCGCTGACCGTCGATGTAGCTAGTAGCATGTAGTGA  

For block elements

  & lt; Textarea style = "width: 100px; p>  
 
 

  for inline elements & lt; Span style = "width: 100px; word-wrap: break-word; display: inline-block;" & Gt; AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA & lt; / Span & gt;